Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3744105
End position: 3744128
Length: 24

DNA sequence
>NC_007626, from 3744105 to 3744128 (24 bp); Magnetospirillum magneticum AMB-1 TCGGCGGCGGCGGCGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3718425-3747014	Sequence	amb3422 - hypothetical protein (Protein is coded in complementary strand; from 3747014 to 3718425)