Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3758191
End position: 3758214
Length: 24

DNA sequence
>NC_007626, from 3758191 to 3758214 (24 bp); Magnetospirillum magneticum AMB-1 GCCTCGGCCGCGGCCTGGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3757261-3758652	Sequence	amb3431 - Outer membrane protein (Protein is coded in complementary strand; from 3758652 to 3757261)