Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3820290
End position: 3820313
Length: 24

DNA sequence
>NC_007626, from 3820290 to 3820313 (24 bp); Magnetospirillum magneticum AMB-1 CGCCGCCGCCGGCCCCGCCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3818651-3820471	Sequence	amb3475 - ABC-type protease/lipase transport system, ATPase and permease components