Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4124170
End position: 4124193
Length: 24

DNA sequence
>NC_007626, from 4124170 to 4124193 (24 bp); Magnetospirillum magneticum AMB-1 TCAGGGCCAGGGCCAGGGGCAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4123449-4124252	Sequence	amb3748 - Flp pilus assembly protein TadD (Protein is coded in complementary strand; from 4124252 to 4123449)