Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4246012
End position: 4246035
Length: 24

DNA sequence
>NC_007626, from 4246012 to 4246035 (24 bp); Magnetospirillum magneticum AMB-1 CCCCCACACCCACCCCCAGCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4245789-4247162	Sequence	amb3846 murD UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase