Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4409645
End position: 4409668
Length: 24

DNA sequence
>NC_007626, from 4409645 to 4409668 (24 bp); Magnetospirillum magneticum AMB-1 GCTGCTGCTGCTGCCGCTGCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4408141-4409709	Sequence	amb3999 - major facilitator superfamily permease