Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4506258
End position: 4506281
Length: 24

DNA sequence
>NC_007626, from 4506258 to 4506281 (24 bp); Magnetospirillum magneticum AMB-1 CCGCCGCCGACGCCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4505622-4506698	Sequence	amb4102 - TRAP-type transport system, periplasmic component