Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4744458
End position: 4744481
Length: 24

DNA sequence
>NC_007626, from 4744458 to 4744481 (24 bp); Magnetospirillum magneticum AMB-1 GAGCCAGACCCAGGGCCAGACCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4743716-4744912	Sequence	amb4339 - hypothetical protein (Protein is coded in complementary strand; from 4744912 to 4743716)