Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4794863
End position: 4794886
Length: 24

DNA sequence
>NC_007626, from 4794863 to 4794886 (24 bp); Magnetospirillum magneticum AMB-1 CGGCGGCGGCGATGGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4793749-4795140	Sequence	amb4391 - S-adenosyl-L-homocysteine hydrolase (Protein is coded in complementary strand; from 4795140 to 4793749)