Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 674494
End position: 674517
Length: 24

DNA sequence
>NC_007626, from 674494 to 674517 (24 bp); Magnetospirillum magneticum AMB-1 GGCCAGGGCCGGGACCAGGACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 672161-674695	Sequence	amb0625 - PAS/PAC domain-containing protein (Protein is coded in complementary strand; from 674695 to 672161)