Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 694126
End position: 694149
Length: 24

DNA sequence
>NC_007626, from 694126 to 694149 (24 bp); Magnetospirillum magneticum AMB-1 ACGGTGTCGGTGTCGGTGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 694072-694356	Sequence	amb0643 - hypothetical protein (Protein is coded in complementary strand; from 694356 to 694072)