Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 810812
End position: 810835
Length: 24

DNA sequence
>NC_007626, from 810812 to 810835 (24 bp); Magnetospirillum magneticum AMB-1 GGCCAGGACCAGGGCCACGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 810729-811418	Sequence	amb0750 - cytochrome b (Protein is coded in complementary strand; from 811418 to 810729)