Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3324217
End position: 3324241
Length: 25

DNA sequence
>NC_007626, from 3324217 to 3324241 (25 bp); Magnetospirillum magneticum AMB-1 GCCCGGCCAGTCCCGGCCAGGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3323844-3324821	Sequence	amb3073 - Na+-dependent transporter (Protein is coded in complementary strand; from 3324821 to 3323844)