Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1193372
End position: 1193398
Length: 27

DNA sequence
>NC_007626, from 1193372 to 1193398 (27 bp); Magnetospirillum magneticum AMB-1 CCAGGTCGTCCAGGTCGGGCAGGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1192966-1194273	Sequence	amb1118 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 1194273 to 1192966)