Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1575010
End position: 1575036
Length: 27

DNA sequence
>NC_007626, from 1575010 to 1575036 (27 bp); Magnetospirillum magneticum AMB-1 TGTCCTATCTGTCCTATCTGTCCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1574866-1576320	Sequence	amb1445 - O-antigen and teichoic acid export protein