Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 2206633
End position: 2206659
Length: 27

DNA sequence
>NC_007626, from 2206633 to 2206659 (27 bp); Magnetospirillum magneticum AMB-1 GCCGCCCAGGCTGCCCAGGCCGCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2206487-2207356	Sequence	amb2029 - branched chain amino acid ABC transporter (Protein is coded in complementary strand; from 2207356 to 2206487)