Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 2446648
End position: 2446674
Length: 27

DNA sequence
>NC_007626, from 2446648 to 2446674 (27 bp); Magnetospirillum magneticum AMB-1 CCACCCGGCCCAACCGGCCCAGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
2446585-2446658	Sequence	amb_t20 Cys tRNA (Protein is coded in complementary strand; from 2446658 to 2446585)