Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3005914
End position: 3005940
Length: 27

DNA sequence
>NC_007626, from 3005914 to 3005940 (27 bp); Magnetospirillum magneticum AMB-1 CCGGGGCCACCCGGGCCACCGGGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3005560-3006054	Sequence	amb2814 - hypothetical protein (Protein is coded in complementary strand; from 3006054 to 3005560)