Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3919863
End position: 3919889
Length: 27

DNA sequence
>NC_007626, from 3919863 to 3919889 (27 bp); Magnetospirillum magneticum AMB-1 CCAGGGTCACCAGGGCCAGCAGGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3919793-3920665	Sequence	amb3565 - ABC-type sulfate transport system, permease component (Protein is coded in complementary strand; from 3920665 to 3919793)