Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1881825
End position: 1881854
Length: 30

DNA sequence
>NC_007626, from 1881825 to 1881854 (30 bp); Magnetospirillum magneticum AMB-1 AGACACCGGATGACCCCGGATGACACCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1881814-1882113	Sequence	amb1733 - hypothetical protein (Protein is coded in complementary strand; from 1882113 to 1881814)