Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3518481
End position: 3518510
Length: 30

DNA sequence
>NC_007626, from 3518481 to 3518510 (30 bp); Magnetospirillum magneticum AMB-1 CGGCTTCGGCCTCGGCCTCCGCTTCGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3517931-3519016	Sequence	amb3255 - FKBP-type peptidyl-prolyl cis-trans isomerase 2 (Protein is coded in complementary strand; from 3519016 to 3517931)