Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 366047
End position: 366076
Length: 30

DNA sequence
>NC_007626, from 366047 to 366076 (30 bp); Magnetospirillum magneticum AMB-1 GGCTCGGGTTCGGGCTCGGGCTCAGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 363896-366556	Sequence	amb0326 - chemotaxis protein histidine kinase-like kinase (Protein is coded in complementary strand; from 366556 to 363896)