Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4237933
End position: 4237962
Length: 30

DNA sequence
>NC_007626, from 4237933 to 4237962 (30 bp); Magnetospirillum magneticum AMB-1 TCCCATGATTTCCCATGATATCCCATTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4237963-4238157	Sequence	amb3838 - hypothetical protein (Protein is coded in complementary strand; from 4238157 to 4237963)