Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 487458
End position: 487487
Length: 30

DNA sequence
>NC_007626, from 487458 to 487487 (30 bp); Magnetospirillum magneticum AMB-1 CCCGGATGAGGCCGGATGTGGCCGGATGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 487373-487711	Sequence	amb0442 - hypothetical protein (Protein is coded in complementary strand; from 487711 to 487373)