Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 524281
End position: 524310
Length: 30

DNA sequence
>NC_007626, from 524281 to 524310 (30 bp); Magnetospirillum magneticum AMB-1 GGAGGAGGTGGAGGTGGAGGGGGAGGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 523295-524326	Sequence	amb0491 - putative protease yhbU precursor (Protein is coded in complementary strand; from 524326 to 523295)