Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 806724
End position: 806753
Length: 30

DNA sequence
>NC_007626, from 806724 to 806753 (30 bp); Magnetospirillum magneticum AMB-1 GCCGTTGCCGTTCCCGTTGCCATTGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 806719-807093	Sequence	amb0745 - hypothetical protein (Protein is coded in complementary strand; from 807093 to 806719)