Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1153057
End position: 1153092
Length: 36

DNA sequence
>NC_007626, from 1153057 to 1153092 (36 bp); Magnetospirillum magneticum AMB-1 GGTTCGGTCGGCGGTGCCGTCGGCGGTTCGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1152902-1153939	Sequence	amb1085 - outer membrane protein domain-containing protein