Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3480486
End position: 3480521
Length: 36

DNA sequence
>NC_007626, from 3480486 to 3480521 (36 bp); Magnetospirillum magneticum AMB-1 GGCTCCGGCTTGGGCTCGGGCTTGGGCTCGGGCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3479937-3480878	Sequence	amb3212 - periplasmic protein TonB, links inner and outer membranes (Protein is coded in complementary strand; from 3480878 to 3479937)