Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4337904
End position: 4337939
Length: 36

DNA sequence
>NC_007626, from 4337904 to 4337939 (36 bp); Magnetospirillum magneticum AMB-1 GGGCTTCCAGCATGGCGTCCAGCAGGGCTTCCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4337078-4338193	Sequence	amb3925 aroB 3-dehydroquinate synthase (Protein is coded in complementary strand; from 4338193 to 4337078)