Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4454335
End position: 4454370
Length: 36

DNA sequence
>NC_007626, from 4454335 to 4454370 (36 bp); Magnetospirillum magneticum AMB-1 TCCGACTTGGGCTCCGGCTTAGGCTCCGGCTTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4451173-4455231	Sequence	amb4056 - RTX toxins and related Ca2+-binding protein (Protein is coded in complementary strand; from 4455231 to 4451173)