Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4753177
End position: 4753212
Length: 36

DNA sequence
>NC_007626, from 4753177 to 4753212 (36 bp); Magnetospirillum magneticum AMB-1 GGGCCACGGTGGGGGCCGCGATGGAGGCCACGGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4753143-4753751	Sequence	amb4348 - ribosomal protein L25 (Protein is coded in complementary strand; from 4753751 to 4753143)