Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 752554
End position: 752589
Length: 36

DNA sequence
>NC_007626, from 752554 to 752589 (36 bp); Magnetospirillum magneticum AMB-1 CCTCGCCTTCGCCCTCGACCTCGGGCTCGCCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 751269-753308	Sequence	amb0697 - RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 753308 to 751269)