Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 1503052
End position: 1503096
Length: 45

DNA sequence
>NC_007626, from 1503052 to 1503096 (45 bp); Magnetospirillum magneticum AMB-1 CGGGGCTCCTCGCGGCGGGGTTCGTCGCGCCGGGGTTCTTCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1502815-1504566	Sequence	amb1385 - superfamily II DNA/RNA helicase (Protein is coded in complementary strand; from 1504566 to 1502815)