Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3338164
End position: 3338208
Length: 45

DNA sequence
>NC_007626, from 3338164 to 3338208 (45 bp); Magnetospirillum magneticum AMB-1 CCACCCGGGGCCATTCCGCCGGGAGCCATTCCACCCGGGGCCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3338125-3338676	Sequence	amb3089 - hypothetical protein (Protein is coded in complementary strand; from 3338676 to 3338125)