Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3579639
End position: 3579683
Length: 45

DNA sequence
>NC_007626, from 3579639 to 3579683 (45 bp); Magnetospirillum magneticum AMB-1 AGGAGGCGGTGGCGGCGGAGGAGGTGGAGGTGGAGGTGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3576688-3580512	Sequence	amb3299 - RTX toxins and related Ca2+-binding protein (Protein is coded in complementary strand; from 3580512 to 3576688)