Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 988116
End position: 988160
Length: 45

DNA sequence
>NC_007626, from 988116 to 988160 (45 bp); Magnetospirillum magneticum AMB-1 ATCAGCATGGAGGTGACCAGCATGGAGGTGACCAGCATGGAGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 988047-988178	Sequence	amb0920 - hypothetical protein (Protein is coded in complementary strand; from 988178 to 988047)