Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3843921
End position: 3843974
Length: 54

DNA sequence
>NC_007626, from 3843921 to 3843974 (54 bp); Magnetospirillum magneticum AMB-1 GGCGACGACGCCGGCGGCGGCGGCGGCGGCGGCGGCGGTGACGCCGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3843841-3845022	Sequence	amb3498 fliM flagellar motor switch protein FliM