Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 3637639
End position: 3637701
Length: 63

DNA sequence
>NC_007626, from 3637639 to 3637701 (63 bp); Magnetospirillum magneticum AMB-1 TCGTCCTCGACGACGGAAGGCTCCTCCTCGACGATGGGAGACTCGTCCTCGGCGACCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3636445-3639849	Sequence	amb3347 - Calphotin; microtubule-associated protein 4 (Protein is coded in complementary strand; from 3639849 to 3636445)