Sequence retrieval

Genome: Magnetospirillum magneticum AMB-1
Start position: 4017586
End position: 4017648
Length: 63

DNA sequence
>NC_007626, from 4017586 to 4017648 (63 bp); Magnetospirillum magneticum AMB-1 CAGTTCCTCGTTGGTGGATTGCAGTTCCTCGTTGGCGGATTTCAGCTCCTCGTTGGAGGATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4016777-4019647	Sequence	amb3654 - hypothetical protein (Protein is coded in complementary strand; from 4019647 to 4016777)