Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1004025
End position: 1004048
Length: 24

DNA sequence
>NC_007651, from 1004025 to 1004048 (24 bp); Burkholderia thailandensis E264 CCGCCGCCGCCGCCGTCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1003922-1004419	Sequence	BTH_I0879 - endo/excinuclease domain-containing protein (Protein is coded in complementary strand; from 1004419 to 1003922)