Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1073394
End position: 1073417
Length: 24

DNA sequence
>NC_007651, from 1073394 to 1073417 (24 bp); Burkholderia thailandensis E264 TCGATCTCGCTCTCGTTCTCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1072452-1074812	Sequence	BTH_I0948 - EAL/GGDEF domain-containing protein (Protein is coded in complementary strand; from 1074812 to 1072452)