Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1196408
End position: 1196431
Length: 24

DNA sequence
>NC_007651, from 1196408 to 1196431 (24 bp); Burkholderia thailandensis E264 GCGCGCGTGCGCGTGCGCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1195868-1196518	Sequence	BTH_I1053 - lipoprotein (Protein is coded in complementary strand; from 1196518 to 1195868)