Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1371538
End position: 1371561
Length: 24

DNA sequence
>NC_007651, from 1371538 to 1371561 (24 bp); Burkholderia thailandensis E264 GCGCCGACGCTCCGACGCTCCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1369718-1371538	Sequence	BTH_I1222 - nitrate transporter (Protein is coded in complementary strand; from 1371538 to 1369718)