Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1501851
End position: 1501874
Length: 24

DNA sequence
>NC_007651, from 1501851 to 1501874 (24 bp); Burkholderia thailandensis E264 CGATCGCCATCGAGATCGCGAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1501616-1502269	Sequence	BTH_I1335 - BexA (Protein is coded in complementary strand; from 1502269 to 1501616)