Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1604061
End position: 1604084
Length: 24

DNA sequence
>NC_007651, from 1604061 to 1604084 (24 bp); Burkholderia thailandensis E264 GCGGCGGCGACGACGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1603959-1605800	Sequence	BTH_I1421 - serine-type carboxypeptidase family protein