Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1682354
End position: 1682377
Length: 24

DNA sequence
>NC_007651, from 1682354 to 1682377 (24 bp); Burkholderia thailandensis E264 CGAACACGATCACGAACGCGAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1682266-1683372	Sequence	BTH_I1484 - undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase (Protein is coded in complementary strand; from 1683372 to 1682266)