Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1696227
End position: 1696250
Length: 24

DNA sequence
>NC_007651, from 1696227 to 1696250 (24 bp); Burkholderia thailandensis E264 GGTGCCGGTGGCGGGGCCCGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1695019-1696713	Sequence	BTH_I1496 ureC urease subunit alpha (Protein is coded in complementary strand; from 1696713 to 1695019)