Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1749806
End position: 1749829
Length: 24

DNA sequence
>NC_007651, from 1749806 to 1749829 (24 bp); Burkholderia thailandensis E264 CGCCCGCGCTCGCACCCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1749745-1751670	Sequence	BTH_I1550 - bifunctional glucokinase/RpiR family transcriptional regulator (Protein is coded in complementary strand; from 1751670 to 1749745)