Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1808563
End position: 1808586
Length: 24

DNA sequence
>NC_007651, from 1808563 to 1808586 (24 bp); Burkholderia thailandensis E264 GGTCGAGATCGAGCTCGAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1806630-1809389	Sequence	BTH_I1608 pepN aminopeptidase N (Protein is coded in complementary strand; from 1809389 to 1806630)