Sequence retrieval

Genome: Burkholderia thailandensis E264
Start position: 1902934
End position: 1902957
Length: 24

DNA sequence
>NC_007651, from 1902934 to 1902957 (24 bp); Burkholderia thailandensis E264 GCCGAAGCCGATGCCCAAGCTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1902433-1903488	Sequence	BTH_I1692 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 1903488 to 1902433)